Development and characterization of high-affinity leptins and leptin antagonists
Published in Journal of Biological Chemistry 286, 4429-42 (2011)
Michal Shpilman1,5, Leonora Niv-Spector,1,5 Meirav Katz2, Chen Varol2, Gili Solomon1, Michal Ayalon-Soffer3, Eric Boder4, Zamir Halpern2, Eran Elinav,2,6 Arieh Gertler1,6
1The Hebrew University, The Robert H. Smith Faculty of Agriculture, Food and Environment, Rehovot 76100, Israel, 2The Research Center for Digestive Tract and Liver Diseases, Tel-Aviv Sourasky Medical Center and the Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel; 3Bioline Innovations, Jerusalem, Israel; 4Department of Chemical and Biomolecular Engineering, University of Tennessee, Knoxville, Tennessee, USA; 5equal first contributors; 6equal last contributors
Abstract
Leptin is a pleiotropic hormone acting both centrally and peripherally. It participates in fof biological processes including energy metabolism, reproduction and modulation of the immune response. So far structural elements affecting leptin binding to its receptor remain unknown. We employed random mutagenesis of leptin, followed by selection of high-affinity mutants by yeast-surface display and discovered that replacing residue D23 with a non-negatively charged amino acid leads to dramatically enhanced affinity of leptin for its soluble receptor. Rational mutagenesis of D23 revealed the D23L substitution to be most effective. Coupling the D23 mutation with alanine mutagenesis of three amino acids (L39A/D40A/F41A) previously reported to convert leptin into antagonist resulted in potent antagonistic activity. These novel superactive mouse and human leptin antagonists (D23L/L39A/D40A/F41A), termed respectively SMLA and SHLA, exhibited over 60-fold increased binding to leptin receptor and 14-fold higher antagonistic activity in vitro relative to the L39A/D40A/F41A mutants. To prolong and enhance in vivo activity, SMLA and SHLA were monopegylated mainly at the N-terminus. Administration of the pegylated SMLA to mice resulted in a remarkably rapid, significant and reversible 27-fold more potent increase in body weight (as compared to pegylated MLA), due to increased food consumption. Thus, recognition and mutagenesis of D23 enabled construction of novel compounds that induce potent and reversible central and peripheral leptin deficiency. In addition to enhancing our understanding of leptin interactions with its receptor, these antagonists enable in vivo study of leptin's role in metabolic and immune processes, and hold potential for future therapeutic use in disease pathologies involving leptin.
Introduction
Leptin, a 16-kDa protein, is a central regulator of body weight (1), as well as a pleiotropic hormone whose involvement in many physiological processes has been well established (2). Leptin's 3-D structure was elucidated shortly after its discovery (3) but so far, no structural information on its complex with leptin receptor has been published. Though several theoretical models of such a complex have been proposed (4-6), lack of a valid crystallographic structure hampers reliable structural interpretation of any new leptin mutations. In the last decade, leptin has also been documented as a major regulator of the innate and adaptive immune response, and a modulator of the onset and progression of autoimmunity in several animal models of disease (7), including rheumatoid arthritis, experimental autoimmune encephalomyelitis (4) and immune-mediated colitis (8). Work published from our and others' laboratories has also shown that leptin enhances thioacetamide-induced liver fibrosis (9) and liver inflammation in several mouse models (10). In addition, leptin acts as a mitogenic agent in many tissues, and is suggested to promote cancer cell growth. In fact, leptin has been shown to act as a growth factor for prostate (11,12), breast (13) and ovarian (14) cancer cells in vitro, to induce increased migration of prostate cancer cells and expression of vascular endothelial growth factor (VEGF), transforming growth factor-beta 1 (TGF-1), and basic fibroblast growth factor (bFGF), and to enhance prostate cancer growth in vivo (11,12).
Consequently, the ability to block leptin’s activity may hold potential for diverse therapies. We previously reported the development of leptin antagonists in four animal species (15,16), by alanine mutagensis of residues LDF (aa 39-41) or LDFI (aa 39-42). Using mouse leptin antagonist (MLA), we demonstrated that inhibition of leptin signaling is beneficial in several mouse models of fibrosis and inflammation (9,10). Pegylation of the antagonist resulted in further improvement of the in vivo antagonistic activity, via inhibition of the endogenous leptin's transport through the brain-blood barrier (17).
The affinity of leptin antagonists toward the leptin receptor is equivalent to that of wild-type (WT) leptin. The thermodynamic consequence of the similar affinity is that occupation of 90% of the receptor necessitates a 10-fold molar excess of antagonist. Enhancing the antagonist’s affinity by 10-fold would lead to similar receptor binding at a 1:1 molar antagonist:agonist ratio. The feasibility of such an approach has been demonstrated with Pegvisomant, a human growth hormone (hGH) mutein carrying nine mutations: one (G120R) converting the agonist into antagonist and eight aimed at increasing affinity toward its receptor. Pegylation of this mutein resulted in an effective drug for the treatment of acromegaly (18-20). Here, we report the discovery of D23 as a residue in the leptin or leptin antagonist, whose mutation to non-negatively charged amino acids confers dramatically enhanced affinity to the receptor. Subjecting this mutein to further mutagenesis and pegylation resulted in the creation of a potent long-acting leptin antagonist which is capable of inducing a dramatic weight increase in naive animals.
Experimental Procedures
Materials — Recombinant soluble human leptin binding domain (hLBD) (21), human leptin triple antagonist and mouse leptin were prepared in our laboratory as described previously (15,16). Synthetic mouse leptin WT cDNA optimized for expression in Escherichia coli was synthesized by Entelechon Co. (Rensberg, Germany). Human leptin and mouse interleukin-3 (mIL3) were purchased from Protein Laboratories Rehovot (Rehovot, Israel). Restriction enzymes used in the molecular biology experiments were from Fermentas (Vilnius, Lithuania). Highly pure DNA primers were ordered from Syntezza (Jerusalem, Israel). Lysis buffer, nalidixic acid, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (thiazolyl blue, MTT), puromycin and kanamycin were purchased from Sigma (Rehovot, Israel). Superdex 75 HR 10/30, 26/60 and Superdex 200 HR 10/30 columns, and Q-Sepharose and SP-Sepharose were from Pharmacia LKB Biotechnology AB (Uppsala, Sweden). Molecular markers for SDS-gel electrophoresis and Bradford protein assay were purchased from Bio-Rad (Rishon leZion, Israel). Bacto-tryptone was from Conda Laboratories (Madrid, Spain). Bacto-yeast extract and Bacto-casamino acids (-Trp, -Ura) were from Difco (Becton Dickinson, Franklin Lakes, NJ). Sulfosuccinimidyl-6-(biotinamido) hexanoate (Sulfo-NHS-LC-biotin) was purchased from Pierce (Rockford, IL). Plasmid pCT302 and strain EBY100 of the yeast Saccharomyces cerevisiae were provided by Dr. E.T. Boder. mAb 9e10 was purchased from Covance (Emeryville, CA), FITC-labeled F(ab')2 goat anti-mouse IgG was from Chemicon (Temecula, CA) and streptavidin-phycoerythrin (SA-PE) conjugate was from BD PharMingen (San Jose, CA). p-STAT-3 (Tyr705) and STAT-3 antibodies were from Cell Signaling (Danvers, MA) and mPEG-propionyl-ALD 20 kDa was purchased from Jenkem Technology USA Inc. (Allen, TX). Fetal bovine serum (FBS), penicillin-streptomycin (‘pen-strep’; 10,000 units/ml and 10,000 mg/ml) and enhanced chemiluminescence (ECL) reagent were from Biological Industries Ltd. (Beit Haemek, Israel). RPMI-1640 medium and DMEM were from GIBCO (Invitrogen, Carlsbad, CA), PelletPaint co-precipitant was from Novagen, EMD Biosciences (Darmstadt, Germany). Luciferase assay reagent was from Promega (Madison, WI), peroxidase-conjugated streptavidin was from Jackson Immuno Research Laboratories (West Grove, PA) and 3,3’,5,5’-tetramethylbenzidine (TMB) was from Dako (DakoCytomation, Copenhagen, Denmark). Other reagents (Tris, cysteine, arginine, NaOH, HCl, boric acid, Tween 20, ultra pure urea, skim milk) were all of analytical grade.
The following kits were purchased: GeneMorph® kit, QuickChange mutagenesis kit and XL-1 Blue cells (Stratagene, La Jolla, CA); Qiagen miniprep and Qiaquick gel extraction kit (Qiagen, Valencia, CA), and Zymoprep II yeast plasmid miniprep kit (Zymo Research, Orange, CA). The following reagents were prepared in our lab: LB (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl, sterilized), TB (80 g/L tryptone, 160 g/L yeast extract, 33.3 g/L glycerol, sterilized), YPD media (10 g/L yeast extract, 20 g/L peptone, 20 g/L dextrose, sterilized), SD-CAA media (20 g/L dextrose, 6.7 g/L Difco yeast nitrogen base, 5 g/L Bacto casamino acids, 5.4 g/L Na2HPO4 and 8.56 g/L NaH2PO4, sterilized), SG-CAA media (as for SD-CAA, but with 20 g/L galactose instead of dextrose), FACS buffer — PBS buffer (8 g/L NaCl, 0.2 g/L KCl, 1.44 g/L Na2HPO4, 0.24 g/L KH2PO4) adjusted to pH 7.4 and supplemented with 5% (w/v) bovine serum albumin (BSA) and 0.05% (w/v) azide, lysis buffer for luciferase activity (25 mM Tris-phosphate, 2 mM DTT, 2 mM CDTA, 10% (w/v) glycerol, 1% w/v Triton X-100, pH 7.8), TN buffer for gel-filtration experiments (25 mM Tris-HCl, pH 8 or 9 containing 300 mM NaCl).
Biotinylation of hLBD — hLBD (0.12 mg/ml) was dialyzed against PBS (pH 7.5) and incubated with a 10-fold molar excess of the biotinylation reagent sulfo-NHS-LC-biotin for 40 min at room temperature. Excess non-reacted biotin was removed by dialyzing against PBS buffer. Biotinylated LBD was equally capable of forming a 1:1 complex with leptin or leptin antagonists as non-biotinylated LBD (not shown).
Yeast-Surface Display of Mouse Leptin — Mouse leptin WT cDNA was modified by PCR to introduce NheI and BamHI restriction sites at the 5' and 3' ends, respectively, enabling subsequent subcloning into acceptor vector pCT302 linearized with NheI and BamHI. The primers used in the PCR were 5'-GTACGCAAGCTAGCGCTGTTCCGATCCAGAAAGTT CAGG-3' to the 5' end and 5'- CGTAGGATCCGCATTCCGGA GAAACGTCCAACTG-3' to the 3' end. The PCR product of mouse leptin was digested with NheI and BamHI, extracted, and ligated into linearized pCT302 expression vector. XL-1 Blue cells were transformed with the new plasmid and plated on LB-agar plates containing 100 µg/ml ampicillin. Fo
ur E. coli colonies were isolated and confirmed to contain the mouse leptin cDNA by digestion with NheI and BamHI restriction enzymes. All of the colonies were positive and one of them was sequenced. Mouse leptin was expressed as an Aga2p protein fusion in S. cerevisiae strain EBY100 by induction in medium containing galactose (22). Hemagglutinin (HA) epitope tag was expressed upstream of the 5' end of the leptin-encoding DNA, and a c-myc epitope tag was attached to the 3' end of the Aga2p-leptin fusion construct; the schematic structure is presented in Fig. 1A. The c-myc epitope tag can be detected by mouse mAb 9e10 and a goat anti-mouse antibody conjugated with FITC. Detection of the c-myc epitope tag at the C terminus of the Aga2p-leptin fusion is indicative of display of the full-length leptin fusion on the yeast cell surface.
Yeast cells transformed with pCT302/mouse leptin WT were grown overnight at 30°C with shaking in 3 ml of selective glucose medium SD-CAA. After ~18-20 h, Aga1p (a membrane yeast protein) + Aga2p-leptin expression was induced at 30°C with shaking in 5 ml of selective galactose medium SG-CAA. Cultures were harvested after ~20 to 24 h (1-2 doublings) by centrifugation, washed with PBS containing 5% BSA and 0.05% azide (FACS buffer) and incubated for 60 min on ice with anti-c-myc mAb 9e10 (1:100 dilution) and biotinylated hLBD (final concentration of ~50 nM), washed with PBS and incubated for 30 min on ice with either FITC-labeled F(ab')2 goat anti-mouse IgG (1:50) or a SA-PE conjugate (1:50) or both. Labeled yeast cells were analyzed on a Beckton Dickinson FACSCalibur flow cytometer at the Flow Cytometry Center of the Weizmann Institute of Science.
Construction of the Mouse Leptin Library—The mouse leptin WT gene was subjected to random mutagenesis using the Stratagene GeneMorph kit to give a high mutagenesis rate. As described in the study by Raymond et al. (23), to obtain the best transformation efficiency, homologous recombination primers were designed so that the inserts would have an ~50-bp overlap at each end with the cut acceptor vector. The primer used to make inserts with 5' homology to the cut vector was 5'-GTGGTGGTGGTTCTGGTGGTG GTGGTTCTGGTGGTGGTGGTTCTGC TAGCGCTGTTCCGATCCAGAAAGTT C- 3', and the primer used to make inserts with 3' homology to the cut vector was 5'-GATCTCGAGCTATTACAAGTCCTCT TCAGAAATAAGCTTTTGTTCGGATC CGCATTCCGGAGAAACGTCCAACT G-3'. We used 0.1 ng of target DNA in the first PCR reaction using 40 cycles, the PCR product was gel-purified and extracted using the Qiaquick gel extraction kit. The resultant PCR product was further amplified with random mutagenesis kit using an aliquot of the first PCR reaction and re-extracted. Then the mutagenized gene was amplified by doing a set of normal PCR (100 reactions of 50 µl each) and re-extracted.The final PCR product was transformed into the yeast along with linearized pCT-mouse leptin. Homologous recombination in vivo in yeast between the 5' and 3' flanking 50 bp of the PCR product with the gapped plasmid resulted in a library of approximately 5 x 105 mouse leptin variants. Mutagenic DNA insert (41 µg) and 8.2 µg of restriction enzyme-linearized pCT302 vector backbone were concentrated with Pellet Paint (Novagen) and transformed into EBY100-competent yeast cells (22) by five electroporations (24). A library of 5 x 105 yeast transformants was obtained, as estimated by plating aliquots of the library and colony counting. The ratio of total insert fragment to cut acceptor vector was maintained at 5:1 for all transformations. Sequencing of 10 clones from the unscreened library indicated mutation frequency (per gene) of 2.6 in the DNA level and 1.9 in amino acids level.
Preparation of Electrocompetent Yeast for Homologous Recombination — Yeast preparation closely followed the method described by Meilhoc et al. (24). First, 50 ml of YPD was inoculated with S. cerevisiae strain EBY100 (22) to an optical density at 600 nm (OD600) of 0.1 from an overnight culture of EBY100 in YPD. Next, the cells were grown with shaking at 30°C to an OD of 1.3 to 1.5 (~6 h of growth). Cells were harvested by centrifugation and suspended in 50 ml cold sterile water. The cells were washed with 25 ml cold sterile water and suspended in 2 ml of 1 M ice-cold sterile sorbitol. Cells were harvested by centrifugation and suspended in 50 µl 1 M sterile sorbitol. Then, electroporation of the suspended cells was carried out using a Bio-Rad Gene Pulser with a 0.2-cm cuvette (voltage 1.5 kV, capacitance 25 µF). After pulsing, the cell aliquots were immediately resuspended in 1 ml of cold 1 M sorbitol and the entire transformation mix was transferred to 50 ml SD-CAA selective medium containing kanamycin (25 µg/ml) and pen-strep (1:100 dilution) for growth at 30ºC. A small aliquot of cells was removed and plated on SD-CAA plates to determine transformation efficiency.
Mouse Leptin Library Screening by Flow Cytometry—A 50-ml volume of pooled transformed cells in SD-CAA selective media was grown overnight at 30ºC with shaking, diluted to an OD600 of 0.05 and grown overnight at 30ºC to OD600 >1.0. A 5-ml volume of SG-CAA was then inoculated to OD600 ~0.5 and grown overnight to an OD600 of 3 or 4. Detailed protocols for screening yeast polypeptide libraries have been described (25). Briefly, 3 x 108 induced yeast cells were then labeled with biotinylated hLBD at a concentration of 50 nM for 1 h at 37ºC in FACS buffer. To detect expression of the C-terminal c-myc epitope tag, mAb 9e10 (at 1:100 dilution) was added simultaneously to the incubation mix. Then yeast cells were washed with ice-cold FACS buffer and resuspended in FACS buffer containing excess cold non-biotinylated hLBD at a concentration of 2000 nM for 2 h at 37ºC. The cells were washed, labeled for 1 h with secondary antibodies: streptavidin conjugated with R-PE (1:50) and a goat anti-mouse antibody conjugated with FITC (1:50). Cells were washed and screened by dual-color flow cytometric sorting for yeast on a Beckton Dickinson FACSAria III cell sorter to isolate clones with improved binding to soluble hLBD, relative to WT leptin. Collected yeast cells were cultured and induced for expression. Three rounds of sorting by flow cytometry were carried out, with regrowth and reinduction of surface expression between each sort. A total of about 1 x 107 cells was examined during the first sorting round and ~5% of the population was collected. After a second round of sorting, 1.6 x 105 cells were collected with 0.5 to 1% stringency and after the third round of screening, 5000 cells with 0.1% stringency were collected. Each library was frozen and saved at -80ºC according to the protocol in Chao et al. (26).
DNA Isolation and Sequencing—After the three rounds of sorting, collected cells were plated on selective medium plates to isolate individual clones. DNA from 40 individual clones was extracted using a Zymoprep kit according to the manufacturer's protocol. The DNA was amplified by transforming into XL-1 Blue cells. Cells were plated on selective LB plates supplemented with 100 µg/ml ampicillin. Colonies from these plates were grown overnight at 37°C in LB media plus 100 µg/ml ampicillin, DNA was isolated using a Qiagen miniprep kit according to the manufacturer's instructions and DNA was sequenced.
Determination of Affinity for Soluble hLBD in Yeast Clones Selected after the Third Round of Screening—Individual yeast cells cloned after the third screen and WT mouse leptin were grown and induced. Cells (1 x 106) were labeled using biotinylated hLBD at different concentrations (1000, 333, 111, 37, 12, 4, 1.37 nM) along with anti-c-myc antibody and secondary fluorescent antibodies as already described. Fluorescence data of c-myc-positive yeast cells were obtained using a FACSCalibur flow cytometer. To calculate the dissociation constant Kd, the mean fluorescence intensity (MFI), obtained with each of the biotinylated hLBD concentrations tested, was then plotted against the hLBD concentration using a non-linear regression (curve fit) with hyperbola equation, analyzed by Prism software (Prisma, GraphPad PrismTM Version 4.0: GraphPAD Software, San Diego,CA).
Preparation of Bacterial Expression Plasmids Encoding Mouse Leptin Muteins—PCR was carried out to introduce NcoI and HindIII restriction sites at the 5' and 3' ends of respectively, enabling subsequent subcloning of the best mutant mouse leptin binder DNA into pMON3401 vector linearized with NcoI and HindIII. The primers used were AAAAAACCATGGCTGTTCCGATCCAGAAAG for the 5' end and AAAAAAA AGCTTTCAGCATTCCGGAGAAACGT CC for the 3' end of the leptin mutant. The cDNA of the mouse leptin muteins in pCT302 was digested with NcoI and HindIII, extracted, and ligated into linearized pMon3401 expression vector. E. coli MON105-competent cells were transformed with the new expression plasmid and plated on LB-agar plates containing 75 µg/ml spectinomycin for plasmid selection. Four E. coli colonies were isolated and confirmed to contain the mouse leptin cDNA by digestion with NcoI/HindIII restriction enzymes. All of the colonies were positive and one of them was sequenced.
Insertion of the L39A/D40A/F41A Mutations into Mouse Leptin Muteins — The procedure used to insert mutations into leptins to create leptin antagonists is disclosed in International Application PCT/IL2005/001250, herein incorporated as a reference (27). To prepare the leptin mutants with antagonistic activity, the pMon3401 expression plasmids encoding six selected mouse leptin muteins were used as starting material. The leptin inserts were modified with the Stratagene QuickChange mutagenesis kit according to the manufacturer’s instructions, using two complementary primers (Supplemental Table 1). The primers were designed to contain base changes (marked in bold) to obtain the respective mutations but still conserve the appropriate amino-acid sequence, and to modify a specific restriction site (underlined) for colony screening. The procedure included 18 PCR cycles using Pfu polymerase. The mutated construct was then digested with DpnI restriction enzyme, which is specific to methylated and hemi-methylated DNA (target sequence: 5'-Gm6ATC-3'), to digest the template and select for mutations containing synthesized DNA. XL-1 competent cells were transformed with the mutated plasmids and grown in 5 ml LB medium and the plasmids were isolated. Five colonies of each mutant were screened for mutation using the specific designed restriction site, and revealed at least 80% efficiency. Two colonies of each mutant were sequenced and confirmed to contain the mutation but no unwanted misincorporation of nucleotides. Mon105 competent cells were then transformed with the plasmids and used for expression.
|
Table 1. Sequence changes in 40 clones selected after 3 screening cycles
|
|
|
Clone number*
|
Sequence change**
|
|
H1,H23
|
|
|
H2
|
A125T,S132Y
|
|
H3,H4,H5,H8,H9,H11,H13,H15,H21,H26,H31,H35,L2
|
D23G,L68M,S97F,S132Y
|
|
H6,
|
D23G,V30D,Y119H
|
|
H7,H18,H27,H33
|
K11R,Q34R,T37A,F92C,S97Y,I136V
|
|
H12,H20,H24,H25,H28,H29,H32,H36,H37,H38,H39,H40
|
S97Y
|
|
H16
|
D23G,G112S,
|
|
H17
|
S109F
|
|
H19
|
D23G,T37A,G44D
|
|
H22
|
T12I
|
|
H30
|
D23H
|
|
H34
|
No change
|
|
L1
|
D23N,Q34L,L114P
|
|
*H- for higher stringency clones, L- for lower stringency clones. All clones were sequenced with cmyc primer, so the end of C- terminal sequence (12 last amino acids in helix D of leptin) was not sequenced.
** The most frequent mutations change (D23) that was found in 18 clones was underlined.
|
|
Insertion of the D23 Mutation into Plasmid Encoding Mouse and Human Leptin Antagonist — The D23A, D23G, D23L, D23R, D23K, D23F and D23W mutants were prepared as described above and the pMon3401 expression plasmids encoding the MLA were used as starting material. Preparation of the expression plasmid of the human D23L/L39A/D40L/F41A leptin mutant (termed super human leptin antagonist — SHLA) was performed similarly. The primers used were 5'-CAATTGTCACCAGGATTAATCTGAT TTCACACACGCAG (Modified restriction site = VspI (+)) (SEQ ID NO: 29) and 3'-CTGCGTGTGTGAAA TCAGATTAATCCTGGTGACAATTG (SEQ ID NO: 30), as shown in Supplemental Table 1.
Expression, Refolding, and Purification of Mouse Leptin Muteins — The recombinant mutated mouse leptins with an extra Met-Ala (methionine is cleaved by the bacteria) at the N terminus were expressed in 2.5-L culture, upon induction with nalidixic acid, and grown for an additional 4 h. Inclusion bodies (IBs) were then prepared as described previously (28,29) and frozen. Subsequently, IBs obtained from 0.3 L of bacterial culture were solubilized in 50 ml of 4.5 M urea and 40 mM Tris base containing 1 mM cysteine, adjusted to pH 11.3 with NaOH. After 2 h of stirring at 4°C, three volumes of 0.67 M arginine were added to a final concentration of 0.5 M and stirred for an additional 1.5 h. Then, the solution was dialyzed against 10 L of 10 mM Tris-HCl, pH 9, for 60 h, with five or six external solution exchanges. NaCl was added to a final concentration of 100 mM and the protein solution was then applied at maximal flow rate (400-500 ml/h) onto a Q-Sepharose column (5-ml bead volume), pre-equilibrated with 10 mM Tris-HCl, pH 9, containing 100 mM NaCl. The breakthrough fraction, which contained the respective leptin mutein, was collected and concentrated to 2-3 mg protein/ml. Then, 18-ml portions were applied to a preparative Superdex 75 column (26/60 cm) pre-equilibrated with 25 mM Tris-HCl, pH 9, containing 300 mM NaCl (TN buffer). Fractions containing the monomeric protein as determined by gel filtration on analytical Superdex 75 HR 10/30 column (1/30 cm) were pooled, dialyzed against NaHCO3 to ensure a 4:1 protein-to-salt ratio, and lyophilized.
Large-Scale Purification of Mouse and Human Leptin D23L/L39A/D40L/F41A Antagonist —The procedure was essentially as described above with the following changes: IBs obtained from 3 L of bacterial culture were solubilized in 400 ml of 4.5 M urea and 40 mM Tris base containing 1 mM cysteine, adjusted to pH 11.3 with NaOH. After 48 h of stirring at 4°C, three volumes of 0.67 M arginine were added to a final concentration of 0.5 M. Then, the solution was dialyzed against 10 L of 10 mM Tris-HCl, pH 9, for 60 h, with five or six external solution exchanges. Then 150 mM NaCl was added and the protein was applied on a Q-Sepharose column (30-ml bead volume). The flowthrough fraction was collected and the monomeric SMLA was isolated using preparative gel filtration in TN buffer, pH 9, followed by dialysis, and lyophilization was conducted as described previously for MLA (16). The protocol used for preparation of SHLA was identical to that published for human L39A/D40L/F41A (15).
Determination of Purity and Monomer Content — SDS-PAGE was carried out according to Laemmli (30) in a 15% polyacrylamide gel under reducing and non-reducing conditions. The gel was stained with Coomassie Brilliant Blue R. Gel-filtration chromatography was performed on a Superdex 75 HR 10/30 column with 0.2-ml aliquots of the Q-Sepharose-column-eluted fraction using TN buffer (25 mM Tris-HCl, 300 mM NaCl, pH 8).
Pegylation of SMLA and SHLA — mPEG-propionyl-ALD 20 kDa was used for pegylation under conditions that favor pegylation of the N-terminal amino group. SMLA or SHLA (150 mg) was dissolved in 111 ml of 0.1 M Na-acetate buffer (pH 5) and centrifuged at 35,000 x g for 10 min to remove the insoluble material. Then 0.2 M NaBH3CN (2.7 ml) was added and the dissolved protein was conjugated with 1.5 g mPEG-propionyl-ALD 20 kDa dissolved in 15 ml of 1 mM HCl. After 20 h of stirring at 4°C, 160 µl of acetic acid (17 M) was added. The solution was stirred for a few seconds, diluted with 1 L ddH2O and applied at maximal flow rate (400-500 ml/h) onto an SP-Sepharose column (20-ml bead volume), pre-equilibrated with 10 mM Na-acetate, pH 4. The column was then washed with 400 ml of 10 mM Na-acetate, pH 4, and the pegylated protein was eluted in 10 mM Na-acetate, pH 5, containing 50 and 75 mM NaCl. Fractions containing the mono-pegylated protein as determined by gel filtration on an analytical Superdex 200 column (1/30 cm) were pooled, dialyzed against NaHCO3 to ensure a 2:1 protein-to-salt ratio and lyophilized. Protein concentrations were determined by absorbance at 280 nm using an extinction coefficient (for 0.1% solution of pegylated protein of 0.200 mg/ml. These values apply to the protein part of the pegylated product.
Binding Assay—Biotinylated mouse leptin served as the ligand in all competitive-binding experiments and the respective mouse leptin muteins as competitors. The hLBD was used as the receptor source. Polystyrene 96-well microtiter plates were coated overnight at 4ºC with 100 µl of 40 pM hLBD in PBS pH 7.4. Wells were then washed once with PBST (PBS containing 0.05% (w/v) Tween 20) and blocked with PBS containing 3% (w/v) skim milk for 2 h at room temperature. All further incubations were carried out at room temperature. Wells were washed again once with PBST and incubated with different concentrations of unlabeled leptins (50 µl/well) for 30 min, and then 50 µl of 62.5 pM biotinylated mouse leptin was added to each well for another 2 h. Then the wells were washed three times with PBST and incubated with 1:30,000 streptavidin-HRP in PBS containing 1% Tween 20 for 1 h. Wells were washed three times with PBST and the reaction was quantified at 450 nm by ELISA Micro-Plate Reader ELx808 – Bio-Tek Instrument Inc. (Winooski, VT) using TMB according to the manufacturer’s instructions.
Kinetics Measurements of SMLA- and SHLA-hLBD Interactions — The kinetics and equilibrium constants for the interactions between hLBD and SMLA or MLA or SHLA were determined by surface plasmon resonance (SPR) methodology using a Biacore 3000 instrument (Neuchatel, Switzerland) at 25°C (31). SMLA, MLA or SHLA were immobilized in a flow cell on a research-grade CM5 sensor chip using amine-coupling chemistry. Immobilization steps and experimental procedure are described in Niv-Spector et al. (15). For the binding studies, hLBD was dissolved in HBS-EP buffer (10 mM Hepes, 150 mM NaCl, 3.4 mM EDTA and 0.005%, v/v, surfactant P20 at pH 7.4) and passed at different concentrations (0, 0.4, 0.8, 1.9, 3.9, 7.8 and 15.6 nM) through flow cells carrying MLA or SMLA or SHLA at a rate of 30 μl/min. The surface was regenerated after each interaction with a 10-μl pulse of 4 M MgCl2. The experiments were analyzed using the Kinetics Wizard (Biacore control software). The resultant binding curves were fitted to the association and dissociation phases at all hLBD concentrations simultaneously, using Biacore evaluation software.
BAF/3 Proliferation Assays — The proliferation rate of leptin-sensitive BAF/3 cells stably transfected with the long form of human leptin receptor was used to estimate both agonistic and antagonistic activity of leptins and leptin muteins as described previously (29). To determine antagonistic activity, 0.05 ng WT homologous leptin was added to each well, which also contained different concentrations of muteins. The average absorbance in wells without leptin (negative control) was used as a blank value and subtracted from other absorbance values to yield the corrected absorbance values. The average absorbance in wells with WT leptin after subtracting the negative control was used as a positive control to calculate percent inhibition. The inhibition curves were drawn using Prisma (4.0) nonlinear regression sigmoidal one-site competition program and the IC50 values were calculated. Note that all mammalian leptins are capable of activating human leptin receptor to an almost identical degree (28,29,32).
Determination of Biological Activity by Activating Luciferase Reporter Gene — The H-49 cell line, received from Dr. M. Einat (ARO, Israel), consists of HEK-293 cells stably transfected with three constructs: phOB-Rb (long form of human leptin receptor), pAH32 (luciferase reporter construct) and pgkPuro (expression vector containing the puromycin resistance gene) at a ratio of 4:4:1 as described previously (33). H-49 cells were briefly dissociated with trypsin and resuspended in DMEM supplemented with 10% (v/v) FBS, 50 µg/ml streptomycin, 50 units/ml penicillin and 2 µg/ml puromycin. Resuspended cells were plated in 24-well tissue-culture plates at 5 x 105 cells per well in a final volume of 500 µl. After 16 h, the medium in each well was replaced with 300 µl DMEM. Mouse leptin mutants were added at different concentrations with a constant concentration of WT mouse leptin. The dilutions were made in DMEM supplemented with 0.5% BSA. Three replicates were used for each concentration and a triplicate without leptin served as a negative control. After 18 h of incubation at 37ºC (CO2/O2 5:95), the cells were harvested with 100 µl lysis buffer and frozen at -80ºC. Each cell lysate (50 µl) was mixed with Promega luciferase assay reagent and luciferase activity was determined. The measured luminescence was normalized to the amount of protein in each well. Protein concentration was measured by Bradford assay according to the manufacturer’s protocol. The results were analyzed by Prism software, according to a non-linear regression one-site competition curve.
STAT-3 Phosphorylation Inhibition — CHO cells (0.5 x 105 cells per well) stably expressing the long form of mouse leptin receptor (ObRb) were seeded in 24-wells plates, grown to 80% confluence and then in serum-deprived medium for 16 h before stimulation with hormones. Then cells were incubated in serum-free medium in the presence or absence of various concentrations (0.2-12.8 μg/ml) of MLA or SMLA and one concentration of WT mouse leptin (0.1 µg/ml) for 20 min in 0.5 ml in 24-well plates. Following these treatments, cells were harvested in 75 µl of ice-cold lysis buffer. Lysates were clarified by centrifugation at 35,000 x g for 10 min and supernatants kept for western blot analyses. Protein concentrations of supernatants were determined using the Bradford assay. Cell proteins (20 µg) were resolved in SDS-PAGE followed by western blot using p-STAT-3 (Tyr705) (cat #9138) and STAT-3 (cat #9132) antibodies. Then, western blot bands were revealed by ECL.
In vivo Experiments — Male C57Bl mice were intraperitoneally administered with pegylated MLA (PEG-MLA) or superactive MLA (PEG-SMLA) at 6.25 mg/kg day for a period of 20 days. During this period, food intake and weight gain were recorded daily and averaged for a period of 7 days. In the weaning part of the experiment, the treatment was ceased after 20 days and reversibility of the leptin deficiency phenotype was recorded. The second experiment was carried out in a similar manner using four doses of either PEG-MLA or PEG-SMLA: 20, 6.7, 2.2 and 0.72 mg/kg/day and lasted 17 days. In all experiments, animals were maintained under 12-h light-dark cycles, in accordance with regulations of the institutional animal and care authority of the Tel Aviv Sourasky Medical Center.
Results
Non-Biased Screening for Leptin Mutants with Improved Binding to Soluble Human Leptin Receptor — To generate a leptin mutant yeast-display library, mouse leptin was expressed on the surface of yeast cells as a fusion to the Aga2p agglutinin subunit and a c-myc tag, on the surface of yeast (22) as shown in Fig. 1A. In-frame surface expression of the full-length Aga2p + leptin fusion protein was established by flow-cytometric c-myc labeling, while affinity to leptin receptor was confirmed by binding to a fluorescently labeled hLBD (Fig. 1B). As a negative control, yeast displaying an irrelevant EGFR did not show any signal (data not shown). For construction of the yeast-displayed leptin-mutant library, leptin cDNA was randomly mutated (Stratagene GeneMorph random mutagenesis kit), followed by cloning into the pCT302 vector to form a leptin mutant-Aga2p agglutinin subunit-c-myc fusion transcript. Electroporation into the yeast yielded a leptin-mutant library with 5 x 105 clones. This library was screened by three rounds of flow-cytometric sorting, with regrowth and reinduction of surface expression between each sort, to isolate clones with improved binding to hLBD. In each round of selection, the yeast library was screened by dual-fluorophore flow cytometry for clones that display both full-length leptin (as determined by expression of the c-myc epitope tag), and binding to biotinylated hLBD. The screening approach used a kinetic binding screen, by labeling yeast to saturation with fluorescently labeled hLBD and then incubating in the presence of excess non-fluorescent hLBD competitor (Fig. 1C and 1D). Cells that exhibited fluorescence after being competed-off by non-biotinylated hLBD were collected for regrowth (Fig. 1D). Forty mutants obtained in the third selection cycle (38 mutants with higher gating stringency (0.1%) and two with lower stringency (0.5%) were sequenced resulting in the identification of 13 new and distinct sequences, with a total of 23 amino-acid changes ranging from 1 to 6 amino acids (Table 1). The most frequent mutation that occurred in 18 out of 40 clones was exchange of D23 to G, H or N.
The approximate affinity of the surface-displayed mouse leptin mutants was determined in situ on the cell wall by titrating whole cells with varying concentrations of biotinylated hLBD. Equilibrium binding was measured by analyzing cell-bound hLBD and c-myc-positive labeling in 13 distinct clones (identified in Table 1) by flow cytometry. Non-linear regression (curve fit) of these data indicated up to 3-fold increased affinity in 7 out of 13 leptin mutants (H30, H15, H22, H12, H16, H19 and H7) as shown in Supplemental Fig. 1. H12 was included despite its marginal increase in the affinity.
Preparation and Characterization of Mutants of Mouse Leptin and Leptin Antagonists —Seven mouse leptin mutants that were selected by yeast-surface-display screening (see above and in Table 2) were expressed in E. coli, refolded and purified as recombinant proteins by consecutive anion-exchange and gel-filtration chromatography as described in Experimental Procedures. In the initial experiments, the H7 mutant did not show any increase in affinity, and the corresponding L39A/L40A/F41A mutant was therefore not prepared. To obtain six other respective MLAs, all six leptin mutants were also inserted, with the L39A/D40A/F41A mutations and purified. All 13 proteins (7 leptins and 6 mutated MLAs) were tested for purity using SDS-PAGE and found to be over 99% pure with over 95% monomer content (not shown). It should be noted that all the recombinant proteins prepared in E. coli are untagged proteins devoid of HA or c-myc sequences.
The 13 recombinant muteins were subsequently tested for an eventual change in binding properties by binding to immobilized hLBD, and for their agonistic or antagonistic activity using the BAF/3 cell-proliferation assay and activation of luciferase reporter gene in H-49 cells. As shown in Table 2, the most potent mutein was derived from clone H30 bearing the mutation D23H. However, elevated activity was also found in proteins derived from clones H15, H16 and H19, all having the D23 mutated to glycine but also having additional mutations (Table 2). In contrast, proteins derived from clone H12 featured no increase in affinity or bioactivity. Only one protein derived from clone H22, lacking the D23 mutation and having only one mutation (T12I), showed a moderate increase in affinity and bioactivity (the latter as antagonist only). To examine whether the T12I mutation may have an additive effect to that of D23 we prepared 3 double mutants (T12I/D23H, T12I/D23R and T12I/D23L) of MLA, but neither their inhibitory activity in BAF/3 bioassay nor their binding affinity toward hLBD were superior to that of D23H or D23R or D23L MLA respectively (not shown). Interestingly, whereas the changes in the binding properties of the agonists and antagonists were highly comparable, the biological activity as determined in BAF/3 bioassays was elevated only in the antagonists.
Assessment of the Role of D23 by Rational Mutagenesis of MLA — To further assess the role of the D23H mutation in increasing the biological activity of MLA, D23 was replaced by small (G, A), hydrophobic (L, F, W) or positively charged (K, R) amino acids using rational mutagenesis. All seven mutants were purified as recombinant proteins by consecutive refolding, dialysis, anion-exchange and gel-filtration chromatography and found pure by SDS-PAGE, containing over 98% monomers (). These mutants were tested for binding affinity toward hLBD and for their biological inhibitory potency in a BAF/3 proliferation assay, and D23L (Table 3) was found to exhibit the highest affinity. Therefore, we chose to use this mutant in all further experiments.
|
Table 3. Activity summary of mouse leptin antagonists D23 mutants
|
|||
|
Mutant
|
Binding assay*
|
BAF/3 bioassay*
|
Luciferase bioassay*
|
|
D23H
|
34 ± 3.15 (8)
|
5 ± 0.34 (5)
|
NT
|
|
D23G
|
17.5 ± 4.50 (2)
|
2.5 ± 0.05 (2)
|
NT
|
|
D23A
|
21 ± 1.00 (2)
|
3.3 ± 0.75 (2)
|
NT
|
|
D23L
|
64 ± 5.82 (6)
|
14.7 ± 0.43 (4)
|
13.4 ± 1.50 (7)
|
|
D23K
|
19 ± 9.00 (2)
|
3.7 ± 0.35 (2)
|
NT
|
|
D23R
|
51 ± 3.95 (6)
|
8.6 ± 1.15 (2)
|
NT
|
|
D23F
|
28 ± 3.56 (4)
|
3.7 ± 0.25 (2)
|
NT
|
|
D23W
|
36 ± 6.02 (4)
|
4.2 ± 1.7 (2)
|
NT
|
|
* the numbers show the fold increase in affinity or bioactivity as compared to the WT mouse leptin or WT mouse leptin antagonist and are given as mean ± SEM when the number of experiments were 3 or more and as SD when the number of experiments was 2. The numbers of performed experiments are given in parentheses..
|
|||
Lar
ge-Scale Purification, Pegylation and Characterization of Mouse and Human Leptin D23L/L39A/D40L/F41A Super Antagonists — Prolonging the refolding in 4.5 M urea from 2 to 48 h prior to dialysis (see Experimental Procedures) dramatically improved the yield of the monomeric fraction of the D23L/L39A/D40L/F41A (SMLA), and the final yield of the protein purified from the IBs corresponding to 3 L of fermentation mixture varied between 300 and 400 mg. The protein, designated superactive MLA (SMLA), was over 99% pure according to SDS-PAGE and contained more than 95% monomers (see the respective D23L mutant in Figs. 2 and 3). Its binding affinity toward hLBD was increased by 64-fold and its biological inhibitory activities in vitro in BAF/3 or H-49 cell bioassays were increased by 13.9- and 13.4-fold, respectively (see Table 3 and Fig. 4A,E). Similar results were obtained for SHLA (Fig. 4C,D) and as shown, the biological activities of SHLA and SMLA in H-49 cell bioassays (Fig. 4C) and in binding assays (Fig.4G). were identical To better characterize the
nature of the increased affinity, SMLA and MLA interactions with hLBD were also compared by SPR methodology. The respective kinetic constant kon for MLA and SMLA was 1.32 x 105 and 2.69 x 105 M/s, while the respective koff constant was 1.19 x 10-3 and 2.01 x 10-4 s-1 and the calculated thermodynamic association constant Ka was 1.11 x 108 and 1.34 x 109 M, respectively. This result clearly indicated that the increased affinity of SMLA originates mainly from longer occupation of the receptor. Similar results (kon = 1.68 x 105 M/s, koff = 2.55 x 10-4 s-1 and Ka = 6.59 x 108 M) were also obtained for SHLA.
The biological activities of MLA and SMLA were also tested in a semi-quantitative STAT3 phosphorylation bioassay. A representative experiments (one out of three), shows at least fivefold higher activity of the latter (Fig. 5). Pegylation of this protein carried out by the method described resulted in a yield, varying between 55 to 75 mg of pegylated protein from 150 mg of non-pegylated SMLA. The final preparation of PEG-SMLA shown in Fig 6. (a representative experiment out of 15 performed) was pure by SDS-PAGE criteria and contained ~9% double-pegylated SMLA, 90% mono-pegylated SMLA and
less than 1% non-pegylated SMLA. N-terminal amino acid analysis indicated that the N-terminus is blocked suggesting the pegylation occurred mainly at the N-terminus as suggested by the pegylation protocol of the manufacturer. The nature of the double pegylated SMLA was not tested, but it likely exist as a N-terminus pegylated species with a single or few partially pegylated lysines in one out of ten molecules. As shown by a representative experiment (Fig. 4B,F), the apparent affinity for hLBD and the biological activity in H-49 cells of PEG-SMLA were reduced by 9- and 6.2-fold, respectively, compared to the non-pegylated SMLA. These changes were comparable to the pegylation effect on MLA shown in Fig. 4B,F (7- and 6.3-fold reduction, respectively) and in our recent publication (17). The effects of pegylation on the biological activity of SHLA (Fig. 4,D) and its apparent affinity toward leptin receptor were also similar (Fig. 4H).
Mouse and Human Leptin Antagonists (D23L/L39A/D40A/F41A) Induce a Dramatic Weight Increase — To assess the in vivo activity of SMLA, 6.25 mg/kg PEG-MLA or PEG-SMLA were intraperitoneally administered daily to 7-week-old male C57BL mice. As depicted in Fig. 7 and as published previously (17), administration of PEG-MLA induced a statistically significant weight gain by day 5, reaching a level of 121% ± 1.4 (mean ± SEM) and stabilizing after 8 days of treatment. In comparison, PEG-SMLA induced a weight gain that peaked at 143.4% ± 3.15 on day 17, and stabilized thereafter. The differences in weight gain between PEG-MLA and PEG-SMLA were statistically significant from day 6 on. Weight gain was mediated by differences in food consumption, which was significantly higher in PEG-SMLA-treated mice (4.02 ± 0.17 g/day per mouse) than in both PEG-MLA (3.17 ± 0.56 g/day per mouse) and control mice (2.54 ± 0.14 g/day per mouse, P < 0.01). Throughout the experiment, mice looked healthy and active with no obvious signs of stress. On day 20, three mice from each group were sacrificed, while the remaining mice in each group were taken off the treatments and observed for resolution of the weight gain. During the following 17 days (Fig. 7), mouse weights gradually decreased. A representative figure featuring mice treated with vehicle, PEG-MLA, or PEG-SMLA is depicted in Fig. 7 (lower figure). To
assess the dose-related differences between PEG-MLA and PEG-SMLA, several daily doses of both proteins (20, 6.7, 2.2 and 0.72 mg/kg) were directly compared (Fig.8). At all four concentrations, the weight gain induced by PEG-SMLA was significantly higher than the respective effect of PEG-MLA. A near-identical weight gain (45% ± 3.8%) was obtained by PEG-SMLA at 20 and 6.7 mg/kg. On day 15, the lowest dose of PEG-SMLA (0.72 mg/kg) induced weight gain comparable to that from 20 mg/kg PEG-MLA, indicating that PEG-SMLA efficacy is up to 27-fold greater than that of PEG-MLA. There was a strong correlation between weight gain and food intake. The average food intake (g/day) for the mice injected with PEG-SMLA (20, 6.7, 2.2, 072 mg/kg) was respectively 4.82 ± 0.29, 4.54 ± 0.26, 4.01 ± 0.23 and 3.34 ± 0.16 (mean ± SEM) and the corresponding values for mice injected with PEG
-MLA were 3.58 ± 0.24, 3.36 ± 0.18, 3.12 ± 0.15 and 3.05 ± 0.13, compared to 2.87 ± 0.13 of the control. In contrast, there was almost no difference in water intake, confirming the leptin antagonist’s specific effects on appetite- rather than thirst-regulatory pathways. Finally, we assessed the in vivo effect of PEG-SHLA (Pegylated super active human leptin antagonist) to that of the mouse counterpart (PEG-SMLA). In both mouse and human superactive leptin antagonist, a comparable significant increase in food intake and weight gain was noted (Supplemental Fig. 2).
Discussion
We report the discovery of the D23 residue as a site that modulates leptin binding to its receptor, and show that mutagenesis of this residue is associated with a dramatic increase in leptin’s binding affinity. Though a 3-D leptin structure was reported 13 years ago (3), no crystallized complex between leptin and leptin receptor has yet been elucidated. Lack of such a structure hampers valid structural interpretation of the presently reported D23L or other D23 mutations. Our suggested interpretation is therefore based on theoretical complex models reported in the last few years (4-6), suggesting that leptin has three binding sites that interact with leptin receptor. Site I is poorly described and its importance is connected to formation of the putative hexameric complex composed of 2 molecules of leptin reacting with 4 leptin receptors. Binding site II, which is a major binding site, is found on the surface of helix A and C and binds to the CHR2 (cytokine homology region II) subdomain of the leptin receptor. This subdomain of human leptin receptor was subcloned in our lab and expressed as a soluble recombinant protein termed leptin binding domain (LBD), capable of forming high-affinity 1:1 complex with human or other mammalian leptins (21). This protein, which is also termed CHR2, was used in the present work as a hook to fish out the high-affinity leptin mutants expressed on the surface of yeast cells. Site III presumably binds to the Ig-like domain of the leptin receptor (4) and is necessary for the latter's activation. Using a molecular modeling and mutagenesis approach (4), it was shown that D9, T12, K15, T16 and R20 located on helix A and Q75, N82, D85 and L86 located on helix C (see Fig. 6B in ref 5) are structurally similar and face the same orientation, and are most likely involved in interacting with CHR2. Mutations of those residues, such as D9S, T12Q, K15S, T16N, R20N, Q75S, N82S, D85S and L86A, L86S, L86N and L86Q, significantly lowered the affinity of leptin for CHR2 and affected both binding and leptin receptor signaling (4,5). To date, no report regarding the putative role of D23 has been published; nevertheless, our data (see Table 3) strongly indicate that replacement of D23 by any non-negatively charged amino acid is sufficient to increase affinity for hLBD (CHR2) and subsequent biological activity. The strongest effect was observed with the D23L mutant in binding and cell assays and confirmed in vivo in weight-gain experiments in mice. While the increase in affinity determined by binding assays was up to 60-fold, the increases in the in-vitro bioassays were only ~13- to 14-fold, likely because the cells used in those assays have an excess of spare receptors. The increased binding and resultant elevated antagonistic activity are more difficult to calculate in vivo but as shown above, they are in the range of 9- to 27-fold. Interestingly, we performed an identical D23L mutation in human leptin triple antagonist and obtained in vitro and in vivo binding results identical to those obtained with SMLA.
D23 is located at the C-terminal end of helix A and is oriented in the same direction as R20, T16 and T12 (see Fig.6B in reference 5). Its replacement by non-negatively charged amino acids probably abolishes some as yet unidentified repulsive effect and therefore increases the interaction with LBD. Notably, the amino-acid sequence of helix A in all known mammalian leptins is almost identical and D23 is preserved in all of them, allowing us to speculate that similar mutations on other mammalian leptins will lead to a similar increase in affinity. The increase in affinity occurred in both the antagonist and agonist mutants, but in contrast to antagonists, the biological activity of agonists in the in-vitro cell-based assay was not increased. This is similar to the case of hGH, whose mutant, selected by phage display, also exhibited increased affinity for hGH receptor but was not more active in a cell bioassay (34,35). The reason for this discrepancy is likely related to the fact that the increase in affinity of SMLA and SHLA originates mainly from a decrease in koff, rather than an increase in kon, leading to prolonged receptor occupancy. Such prolonged occupancy makes the antagonist more effective but likely does not increase the activity of the agonist.
When tested in vivo, the resultant superactive antagonist featured dramatic leptin-antagonistic biological activity, which was manifested as significant weight gain driven by an increase in appetite and food consumption. Though pegylation decreased the biological activity in vitro, the in vivo activity was elevated due to prolonged persistence in circulation, consitent with the previously published results (17). The potency and reversibility of the superactive antagonist make it a prime tool for the study of leptin’s peripheral and central activities in adult animals in the steady state, as well as in disease conditions. This tool is far superior to the current main research tool, the leptin-deficient mouse model, in which leptin deficiency in the embryonic and neonatal stages is associated with developmental aberrations that carry limited relevance to WT physiology (36,37). In addition, the superactive antagonists may be studied as potential future therapeutic agents in a myriad of disease conditions in which leptin signaling has been implicated, including solid tumors and auto-inflammatory disorders (38-40). Under these conditions, the use of the superactive leptin antagonist may enable effective and reversible long-acting leptin inhibition with low doses and tolerable frequencies of injection.
Acknowledgments
This work was supported by the Israel Science Foundation, grant no. 521/07 to AG and EE. We thank Dr. M. Einat (ARO, Israel), for HEK-293 cells stably transfected with the three constructs.
Legends to Figures
FIGURE 1. Schematic structure of the leptin-expressing plasmid in yeast cells (A). Yeast-surface display of mouse leptin — the c-myc epitope tag was detected using mouse mAb 9e10 and goat anti-mouse antibody conjugated with FITC and the expressed leptin was detected using biotinylated hLBD and streptavidin-phycoerythrin (SA-PE) conjugate (B), A representative figure from one of the cell sorting experiments: library prior to competition with non-labeled hLBD (C), and library after competition (D). Yeast cells that were not competed-off were collected for an additional cycle of growth and selection.
FIGURE 2. SDS-PAGE of the eight variants of MLA mutated at D23 and run on a 15% gel in the presence (+) or absence (-) of β-mercaptoethanol. WT mouse leptin (mlep) was run as a control. The sizes of the molecular mass markers (from top to bottom in kDa) are: 250, 150, 100, 75, 50, 37, 25, 20, 15 and 10.
FIGURE 3. Gel-filtration analysis of eight variants of MLA mutated at D23 developed on a Superdex 75 column at 0.8 ml/min in TN buffer, pH 8.
FIGURE 4. Comparison of biological activity in H-49 cells (A-D) and binding properties (E-H) of MLA and SMLA (A,C,E,G), of PEG-MLA and PEG-SMLA (B,F) and of HLA, SHLA, (C,D,G,H) and PEG-SHLA (D,H).
FIGURE 5. Comparative inhibition of STAT3 phosphorylation by SMLA and MLA in CHO cells stably transfected with the long form of mouse leptin receptor.
FIGURE 6. (A), SDS-PAGE of PEG-SMLA run on a 12% gel in the presence (+) or absence (-) of β-mercaptoethanol. The molecular mass markers (from top to bottom in kDa) are: 150, 100, 75, 50, 37, 25 and 20. (B), gel-filtration analysis of PEG-SMLA on a Superdex 200 column at 0.7 ml/min in TN buffer, pH 8.
FIGURE 7. (Upper figure) Comparison of the effect of PEG-MLA and PEG-SMLA on weight gain in male mice. Both materials were injected daily at 6.25 mg/kg. After 20 days, the injections were ceased and mouse weight was checked for another 17 days (n = 8 and control n = 5). (Lower figure) Representative male mice treated with vechile (left), PEG-MLA (center), or PEG-SMLA (right). Depicted are the general habitus of mice (A) and appearance of the intact (B) and dissected (C) abdominal fat.
FIGURE 8. Comparison of the effect of PEG-MLA and PEG-SMLA on weight gain in male mice. Each material was injected daily at 20, 6.7, 2.2 and 0.72 mg/kg, n = 8.
References:
- Friedman, J. M., and Halaas, J. L. (1998) Nature 395(6704), 763-770
- Fantuzzi, G., and Faggioni, R. (2000) J Leukoc Biol 68(4), 437-446
- Zhang, F., Basinski, M. B., Beals, J. M., Briggs, S. L., Churgay, L. M., Clawson, D. K., DiMarchi, R. D., Furman, T. C., Hale, J. E., Hsiung, H. M., Schoner, B. E., Smith, D. P., Zhang, X. Y., Wery, J. P., and Schevitz, R. W. (1997) Nature 387(6629), 206-209
- Peelman, F., Van Beneden, K., Zabeau, L., Iserentant, H., Ulrichts, P., Defeau, D., Verhee, A., Catteeuw, D., Elewaut, D., and Tavernier, J. (2004) J Biol Chem 279(39), 41038-41046
- Iserentant, H., Peelman, F., Defeau, D., Vandekerckhove, J., Zabeau, L., and Tavernier, J. (2005) J Cell Sci 118(Pt 11), 2519-2527
- 6. Peelman, F., Iserentant, H., De Smet, A. S., Vandekerckhove, J., Zabeau, L., and Tavernier, J. (2006) J Biol Chem 281(22), 15496-15504
- 7. La Cava, A., and Matarese, G. (2004) Nat Rev Immunol 4(5), 371-379
- 8. Karmiris, K., Koutroubakis, I. E., and Kouroumalis, E. A. (2008) Mol Nutr Food Res 52(8), 855-866
- 9. Elinav, E., Ali, M., Bruck, R., Brazowski, E., Phillips, A., Shapira, Y., Katz, M., Solomon, G., Halpern, Z., and Gertler, A. (2009) Hepatology 49(1), 278-286
- Elinav, E., and Gertler, A. (2009) Use of leptin antagonists as anti-inflammatory and anti-fibrotic reagents. In: Gertler, A. (ed). Leptin and leptin antagonists, Landes Bioscience
- Frankenberry, K. A., Skinner, H., Somasundar, P., McFadden, D. W., and Vona-Davis, L. C. (2006) Int J Oncol 28(4), 985-993
- Somasundar, P., Frankenberry, K. A., Skinner, H., Vedula, G., McFadden, D. W., Riggs, D., Jackson, B., Vangilder, R., Hileman, S. M., and Vona-Davis, L. C. (2004) J Surg Res 118(1), 71-82
- Ray, A., and Cleary, M. P. (2010) Expert Opin Ther Targets 14(4), 443-451
- Choi, J. H., Choi, K. C., Auersperg, N., and Leung, P. C. (2004) J Clin Endocrinol Metab 89(11), 5508-5516
- Niv-Spector, L., Gonen-Berger, D., Gourdou, I., Biener, E., Gussakovsky, E. E., Benomar, Y., Ramanujan, K. V., Taouis, M., Herman, B., Callebaut, I., Djiane, J., and Gertler, A. (2005) Biochem J 391(Pt 2), 221-230
- Salomon, G., Niv-Spector, L., Gussakovsky, E. E., and Gertler, A. (2006) Protein Expr Purif 47(1), 128-136
- Elinav, E., Niv-Spector, L., Katz, M., Price, T. O., Ali, M., Yacobovitz, M., Solomon, G., Reicher, S., Lynch, J. L., Halpern, Z., Banks, W. A., and Gertler, A. (2009) Endocrinology 150(7), 3083-3091
- Muller, A. F., Kopchick, J. J., Flyvbjerg, A., and van der Lely, A. J. (2004) J Clin Endocrinol Metab 89(4), 1503-1511
- van der Lely, A. J., and Kopchick, J. J. (2006) Neuroendocrinology 83(3-4), 264-268
- Kopchick, J. J., Parkinson, C., Stevens, E. C., and Trainer, P. J. (2002) Endocr Rev 23(5), 623-646
- Sandowski, Y., Raver, N., Gussakovsky, E. E., Shochat, S., Dym, O., Livnah, O., Rubinstein, M., Krishna, R., and Gertler, A. (2002) J Biol Chem 277(48), 46304-46309
- Boder, E. T., and Wittrup, K. D. (1997) Nat Biotechnol 15(6), 553-557
- Raymond, C. K., Pownder, T. A., and Sexson, S. L. (1999) Biotechniques 26(1), 134-138, 140-131
- Meilhoc, E., Masson, J. M., and Teissie, J. (1990) Biotechnology (N Y) 8(3), 223-227
- 25. Boder, E. T., and Wittrup, K. D. (2000) Methods Enzymol 328, 430-444
- 26. Chao, G., Lau, W. L., Hackel, B. J., Sazinsky, S. L., Lippow, S. M., and Wittrup, K. D. (2006) Nat Protoc 1(2), 755-768
- Gertler, A. (2006) Trends Endocrinol Metab 17(9), 372-378
- Gertler, A., Simmons, J., and Keisler, D. H. (1998) FEBS Lett 422(2), 137-140
- Raver, N., Vardy, E., Livnah, O., Devos, R., and Gertler, A. (2002) Gen Comp Endocrinol 126(1), 52-58
- Laemmli, U. K. (1970) Nature 227(5259), 680-685
- 31. Gertler, A., Grosclaude, J., Strasburger, C. J., Nir, S., and Djiane, J. (1996) J Biol Chem 271(40), 24482-24491
- Raver, N., Gussakovsky, E. E., Keisler, D. H., Krishna, R., Mistry, J., and Gertler, A. (2000) Protein Expr Purif 19(1), 30-40
- Gertler, A., Niv-Spector, L., and Reicher, S. (2007) Nat Med 13(1), 18-19; author reply 19-21
- Lowman, H. B., and Wells, J. A. (1993) J Mol Biol 234(3), 564-578
- Pearce, K. H., Jr., Cunningham, B. C., Fuh, G., Teeri, T., and Wells, J. A. (1999) Biochemistry 38(1), 81-89
- Udagawa, J., Hashimoto, R., Suzuki, H., Hatta, T., Sotomaru, Y., Hioki, K., Kagohashi, Y., Nomura, T., Minami, Y., and Otani, H. (2006) Endocrinology 147(2), 647-658
- Holness, M. J., Munns, M. J., and Sugden, M. C. (1999) Mol Cell Endocrinol 157(1-2), 11-20
- Ramani, K., Yang, H., Xia, M., Ara, A. I., Mato, J. M., and Lu, S. C. (2008) Hepatology 47(2), 521-531
- 39. Gonzalez-Perez, R. R., Xu, Y., Guo, S., Watters, A., Zhou, W., and Leibovich, S. J. Cell Signal 22(9), 1350-1362
- Siegmund, B., Lehr, H. A., and Fantuzzi, G. (2002) Gastroenterology 122(7), 2011-2025

